геном собаки

 Авто перевод после конвертации из ПДФ. Отредактировать+ попросить разрешение издателя на публикацию перевода. 

https://www.macmillanlearning.com/catalog/static/whf/life9epreview/sample_chapters/life9ech17.pdf 

 

 

 © 2010 Sinauer Associates, Inc.

Canis lupus Familiaris, собака была одомашнена человеком из серых волков тысячи лет назад. Хотя существует много видов волков, все они выглядят более или менее то же самое. Не так с «лучшим другом человека.» Американский клуб собаководства признает около 155 различных пород. Породы собак не только выглядят по-разному, они сильно различаются по размеру. Например, взрослый чихуахуа весит всего 1,5 кг, в то время как дирхаунд весит 70 кг. Ни одно другое млекопитающее не показывает такое большое изменение фенотипического и биологов любопытно, как это происходит. Кроме того, есть вышли ее генетических заболеваний у собак, и многие из этих заболеваний имеют аналоги в организме человека. Для того, чтобы узнать о генах позади фенотипической изменчивости, а также для выяснения отношений между генами и заболеваниями, то Генный собак началась в конце 1990-х годов. С тех пор были опубликованы последовательности нескольких геномов собак. Две собак-боксер и пудель-были первой, чтобы все их геном секвенировали. Собака геном содержит 2,8 млрд пара оснований ДНК в 39 парах хромосом Somes. Есть 19,000 белок-кодирующих генов, большинство из них с близкими аналогами у других млекопитающих, включая человека. Вся последовательность генома сделала это легко создавался съело карту генетических маркеров-специфических нуклеотидов или короткие последовательности ДНК в определенных местах на геноме, которые отличаются между отдельными собаками и / или породами. Генетические маркеры используются для отображения местоположения (и, таким образом, идентифицировать) гены, которые контролируют определенные черты. Для экс-обильного, доктор Элейн Острандер и ее коллеги из NA- нальных институтов здоровья изучали португальские собака воды для того чтобы идентифицировать гены, которые контролируют размер. Отбор проб клеток для выделения ДНК было относительно легко: ватный тампон был унесен по внутренней стороне щеки. Как сказал доктор Острандер, собаки «не волновало, особенно, если они думали, что они собираются, чтобы получить удовольствие или если есть теннисный мяч в нашей с другой стороны.» Оказалось, что ген фактора роста инсулиноподобный 1 (ИФР-1) имеет важное значение при определении размера: крупные породы имеют аллель, который кодирует для активного ИФР-1 и мелких пород имеют различные аллели, который кодирует менее активной IGF-1. Другой ген важен фенотипической изменчивость был найден в уиппетах, гладкие собаки, которые работают быстро и часто мчались. Мутация в гене миостатин, белок, который ингибирует сверхразвитием мышц, приводит к изменению собак Чихуахуа (внизу) и бразильского дога (вверху) одни и те же виды, Canis волчанка Familiaris, и все же показывают значительный разброс в размерах , Секвенирование генома показал понимание того, как размер контролируется генами. Генетическая Bully Эти собаки являются уиппеты, но мускулистый собака (справа) имеет мутацию в гене, который ограничивает наращивания мышечной массы. гончая, что более мускулистым и работает быстрее. Мио- статин играет важную роль в человеческих мышц, а также. Неизбежно, некоторые ученые создали компании, чтобы проверить собак для генетических вариаций, используя ДНК, поставляемые беспокойными владельцами и заводчиками. Некоторые традиционные селекционеры хмуриться на эту практику, но другие говорят, что это улучшит породы и дать больше радости (и престижа) владельцам. Таким образом, вопросы, связанные с Генной собакой не очень отличаются от тех, вытекающих из проекта генома человека. Мощные методы были разработаны для анализа ДНК-последовательности, и полученная в результате информации накопительного mulating быстрых темпов. Сравнения секвенсированных геномов обеспечивают новое понимание эволюционных взаимоотношений и подтверждающие старые. Мы в новой эре биологии. 17,1 How Are геномов Sequenced? Как вы видели в истории открытия на собака, одна из причин SE- quencing геномов для сравнения различных организмов. Другой заключается в выявлении изменений в геноме, которые приводят к болезни. В 1986 году лауреат Нобелевской премии Ренато Дульбекко и другие предложили, что мировое научное сообщество мобилизоваться занижать принять секвенирование всего генома человека. Одна из проблем, обсуждается в то время был для обнаружения повреждения ДНК у людей, переживших атомные взрывы и были подвержены воздействию радиации в Японии во время Второй мировой войны. Но для того, чтобы обнаружить изменения в геноме человека, ученые прежде всего необходимо знать нормальную последовательность. Результат этого стал финансируемым государством Human Genome Pro- Ject, огромная задачей, которая была успешно завершена в 2003 году усилия способствовали и дополнены частному финансируемых группам. Проект выгода от развития многих новых методов, которые впервые были использованы в последовательности меньших геномов-тех прокариот и простого эукариот. Два подхода были использованы для секвенирования генома человека Многие прокариоты имеют одну хромосому, в то время как eukary- РИМЕЧАНИЯ есть несколько многим. Из-за их различных размеров, хромо mosomes могут быть отделены друг от друга, определены и экспериментально манипулировать. Может показаться, что самый простой подход к секвенирования хромосому было бы начать с одного конца и просто о последовательности всей ДНК ecule мол. Тем не менее, этот подход не является практичным, так как только около 700 пар оснований могут быть секвенированы в то время, используя текущий мет- ODS. Прокариотические хромосомы содержат 1-4 миллионов пар оснований и хромосом человека 1 содержит 246 миллионов пар оснований. Для того, чтобы секвенировать весь геном, хромосомная ДНК должна быть разрезана на короткие фрагменты длиной около 500 пар оснований, которые разделены и секвенировали. Для гаплоидного генома человека, который имеет около 3,3 миллиарда пара оснований, существует более 6 мил- лев таких фрагментов. Когда все фрагменты были SE- quenced, проблема в том, как поставить эти миллионы последовательностей вместе. Эта задача может быть выполнена с использованием более крупным, перекрывающихс фрагментов. Проиллюстрируем этот процесс, используя молекулу ДНК сингл, 10 пар оснований (п.о.). (Это молекула двухцепочечной, но для удобства мы показываем только последовательность некодирующая Этот материал не может быть скопирован, воспроизведен, изготовлены или распространяться в любой форме без письменного разрешения издателя. © 2010 Sinauer Associates, Inc. нить.) молекула разрезают три способа. Первый срез генерирует фрагменты: TG, ATG и CCTAC второго разреза ту же самой молекулы генерирует фрагменты: AT, GCC и TACTG Результаты третьего разреза в: КТГЕ, СТО и ATGC Вы можете поместить фрагменты в правильном заказ? (Ответ ATGCCTACTG.) Конечно, проблема упорядочения 6 мил- фрагментов лев, каждая около 500 пар оснований, является более сложной задачей! Поле биоинформатики было разработано для анализа ДНК последовательностей с использованием сложных математических и компьютерные программ. До недавнего времени два основных подхода были использованы для анализа фрагментов ДНК для выравнивания: иерархическую последовательность и дробеструйной ружьем секвенирования. Они были разработаны для проекта генома человека, но были применены для других организмов, а также. ИЕРАРХИЧЕСКАЯ секвенирование Публично финансируемые люди секвенирование генома команда разработала метод, известный как иерархическая последовательность. Первый шаг был систематически иден- тифами коротких последовательностей маркеров вдоль хромосом, гарантируя, что каждый фрагмент ДНК, чтобы быть секвенирован будет содержать маркер (рис 17.1A). Генетические маркеры могут быть короткими торфами тандемов РЕМОНТА (STRs), единичные нуклеотидные полиморфизмы (SNP), или сайты узнавания для ферментов рестрикции, которые распознают и разрежут ДНК в специфических последовательностях (см главу 15). Некоторые ферменты рестрикции распознают последовательность 4-6 пара оснований и генерировать множество фрагментов из большого ДНК мольного Cule. Например, фермент Sau3A разрезает DNA каждый раз, когда он встречает GATC. Другие ферменты рестрикции признают последовательности из 8-12 пар оснований (NotI, разрежут на GCGGCCGC, для рассмота PLE) и генерировать гораздо меньше, но гораздо больше, фрагменты. В иерархической последовательности, геномной ДНК разрезается на множество относительно большой (55 000 до 2 млн п.н.) фрагментов. Если различные ферменты используются в отдельных сборниках, фрагменты будут перекрываться, так что некоторые фрагменты разделяют определенные маркеры. Каждый фрагмент вставляется в бактериальной плазмиды для создания бактериальной искусственной хромосомы (ВАС), который затем вставляется в бактерии. Каждая бактерия получает только одну плазмиды с фрагментом (для рассмота PLE) геном человека и дает возможность расти в колонии ДОГОВОР Taining миллионов генетически идентичных бактерий (так называемый клон). Клоны отличаются друг от друга в том, что каждый из них имеет различный чем фрагмент из генома человека. Коллекция клонов, содержащая много различных фрагментов генома, называется геномной библиотекой. ДНК из каждого клона затем извлекают и разрезают на более мелкие куски перекрывающихся, которые, в свою очередь, клонированных, очищены и секвенированы. Перекрывающиеся части последовательностей позволяют РЕМОНТ искателям (с помощью компьютеров), чтобы выровнять их, чтобы создать полную последовательность клона BAC. Генетические маркеры на каждом клоне ВАС используются, чтобы расположить большие фрагменты в правильном порядке по карте хромосом. Этот метод работает, но медленно. Альтернативный подход, метод дробовик, делает гораздо более широкое использование использования компьютеров для выравнивания последовательностей. yourBio Portal.com СРЕДСТВА ДЛЯ ИЗУЧЕНИЯ ЖИЗНИ секвенирования Геномов Предполагает Фрагмент Перекрытия Короткие фрагменты всего генома могут быть упорядочены, но фрагменты должны быть правильно выровнены. Исторически использовались два подхода. Оба включали использование бактериальных клонов, чтобы отделить и усиливать отдельные фрагменты ДНК. Иерархическая последовательность 1 карта маркера сделана на большом ДНК. Маркеры Ружье секвенирование ДНК случайным образом разбиты на 500 п.о. фрагментов. Несколько вырезы сделаны к ДНК разрезается на фрагменты 55,000 до 2 миллионов пар оснований. Несколько надрезы для создания перекрывающихся фрагментов. создать перекрывающиеся фрагменты. Каждый фрагмент усиливается и каждый фрагмент усиливается в бактериальной искусственной хромосомы (BAC). секвенировали. Компьютер находит последовательность разделяет фрагменты (перекрытия), и выравнивает фрагменты. Последовательности маркеров идентифицированы на фрагменты; распространенные из них указывают на перекрытие. Фрагменты BAC разрезают на мелкие кусочки и секвенированы от маркера к маркеру, 500 пар оснований за один раз. СРЕДСТВА ДЛЯ ИССЛЕДОВАНИЯ жизни секвенирования ДНК Нормальных субстратов для репликации ДНК являются дНТФом. Химически модифицированные структуры ддНТФа вызывает синтез ДНК, чтобы остановить. (В) При меченном ддНТФ включены в реакционной смесь для репликации ДНК-матрицы неизвестной последовательности, результат представляет собой набор фрагментов различной длины, которые могут быть разделены с помощью электрофореза. База (А, Т, G или С) Основанием (А, Т, G или С) (А) методом дробовик Вместо отображения генома и создания библиотеки BAC, метод секвенирования Ружья включает в себя непосредственно резка ge- мической ДНК в меньше, перекрывающиеся фрагменты, которые клонируют и SE- quenced. Мощные компьютеры выравнивание фрагментов путем нахождения mologies последовательности НО- в перекрывающихся областях О -O POO- О OPOO- О- СН2-O O O O POO- OPOO- O-CH2-O (рис 17.1B). Как секвенирования тех- гий и компьютеры улуч- шаться, дробовик подход H H Бе деоксирибонуклеозид H H трифосфата (дНТФ) 2 'Dideoxyribonucleoside трифосфат (ддНТФ) H H H H 3' 2 'приходят гораздо быстрее и дешевле, чем иерархический подход. (Нормальный) HO H (химически модифицированный) НН В качестве демонстрации, исследователи использовали этот метод для последовательности фрагмента 1,8 1 ДНК, для которой последовательность оснований должна быть определена изолирована и служит в качестве шаблона. 2 Каждые из ддНТФа связан с флуоресцентным красителем. Отсутствие ОН в положении 3 'означает, что дополнительные нуклеотиды не могут быть добавлены. 5 '??????????????????? ? 3 'ддЦТФ ddGTP ddTTP ddATP C G T A миллионов пар оснований прокариотических геномов в течение нескольких месяцев. Затем появились большие геномы. Весь 180 миллионов base- пара плодовая мушка генома секвенируют методом дробовика в чуть более года. Этот успех доказал, что метод дробовика может работать гораздо больший человеческий геном, а на самом деле он был использован для секвенирования влажности от Пробы неизвестной ДНК в сочетании с праймером, ДНК-полимеразой, дНТФом и флуоресцентным ддНТФом. Синтез начинается. Шаблон нити 5 '???????????????? CGCA 3' 5 Вновь синтезированные фрагменты различной длины разделены с помощью электрофореза. Грунтовка люди геном быстро по сравнению с методом erarchical хай. Последовательность нуклеотидов ДНК может быть определена Как индивидуальная ДНК Фрагментар Результаты показаны здесь, что связывается с Т в неизвестном шаблоне. Если ddATP А добавлен, синтез останавливается. Серия фрагментов различной длины производится, каждые из которых заканчивается с ддНТФом. 3 'GCGT 5' 5 'Т ??????????????? CGCA 3' 3 'AATCTGGGCTATTCGGGCGT 5' 5 'ТТ ?????????????? CGCA 3 '3' ATCTGGGCTATTCGGGCGT 5 '(последовательность известна) Электрофорез AA T CTGGGC 3' Самый длинный фрагмент детектора Ментов, генерируемые иерархическим или дробовика методов секвенировали? В настоя- методы аренды являются разновидностями метод, разработанный в конце 1970-х годов Фредерик Sanger. Этот метод использует химически модифицированные нуклеотиды, которые первоначально были разработаны, чтобы остановить деление клеток при раке. Как мы обсудим в главе 13, deoxyribonu- cleoside трифосфатов (дНТФ) являются 6 Каждый фрагмент флуоресцирует цвет, который идентифицирует ддНТФ, завершившего фрагмент. Цвет в конце каждого фрагмента обнаруживается с помощью лазерного луча. Последовательность ДНК теперь может быть выведена из цветов каждого фрагмента ... ... и преобразуется в лазерном TAT TC G Кратчайший G фрагмента 5 'нормальные субстраты для ДНК repli- катионов и содержит сахар де- oxyribose. Если сахар заменен 2,3-dideoxyribose, полученный dideoxyribonucleoside трифосфат (ддНТФ) по-прежнему будут добавлены с помощью ДНК-полимеразы к растущей цепи polynu- cleotide. Однако, поскольку ддНТФ не имеет гидроксильной группы (-ОН) в 3'-положении, следующий Nu- cleotide не может быть добавлен (рис последовательности матричной нити. 3 'AATCTGGGCTATTCGG 5' 5 'TTAGACCCGATAAGCCCGCA 3' А). Таким образом, синтез останавливается в положении, где ддНТФ была не- Корпорейтед в растущий конец цепи ДНК. Для того, чтобы определить последовательность фрагмента ДНК (обычно не более 700 пар оснований), он изолирован и смешивает с ДНК-полимеразой Коротким праймером подходит для ДНК-последовательности Четыре дНТФа (дАТФ, дГТФ, дЦТФ и дТТФ) Небольшие количества из четырех ддНТФ, каждый св зан с по-разному окрашенных флуоресцентным «метки» 17.3 высокопроизводительного секвенирования Высокоскоростной секвенирование быстрее и дешевле, чем традиционные методы, а также включает в химической амплификации ДНК-фрагментов. Одним из примеров высокой пропускной последовательности показан здесь. СРЕДСТВА ДЛЯ ИССЛЕДОВАНИЯ LIFEIn первой стадии реакции, ДНК нагревают до денатурации его (разделить его на одиночные цепи). Только одна из этих нитей будет выступать в качестве шаблона для sequenc- ИНГ-та, к которой праймер связывается. ДНК repli- катионные протекает, и пробирка вскоре содержит смесь исходных нитей ДНК и короче, новых комплементарных нитей. Новые нити, каждая из конечных ИНГ флуоресцентным ддНТФ, имеют различную длину. Например, каждый раз, когда Т достигается на матричной нити, ДНК-полимераза добавляет либо дАТФ или ddATP к растущему комплементарной нити. Если добавляется дАТФ, прядь продолжает расти. Если добавляется ddATP, рост прекращается (рис 17.2B). После репликации ДНК позволили про- Ceed на некоторое время, новые ДНК-фрагменты являются dena- комплекс- ного и одноцепочечные фрагменты, разделенные электрофорезом (рис 15.8), который сортирует фрагменты ДНК длиной. Во время electrophore- перспективы SiS, фрагменты проходят через лазерный луч, который возбуждает флуоресцентные метки, и отличительный цвет света, излучаемый каждый ддНТФ обнаруживается. Цвет указывает, какой ддНТФ находится в конце каждой нити. Компьютер обрабатывает эту информацию и выводит последовательность ДНК-фрагмента (рис 17.2B). Поставка химических реагентов с помощью автоматизированных машин, в сочетании с автоматизированным анализом, сделали секвенирование ДНК быстрее, чем когда-либо. Огромные лаборатории компании методы часто называют массовым параллелизмом секвенирования ДНК, потому что тысячи или миллионы реакций секвенирования запускаются сразу значительно ускорить процесс. Одним из таких методов высокой пропускной способности иллюстрируется на рис 17.3. В одном из 7-часовой перспективы, эти машины могут последовательно 50000000 пар оснований ДНК! Как это работает? yourBio Portal.com GO TO анимированные Учебник 17,2 • высокая пропускная способность секвенирования ДНК 1 Большая молекула ДНК разрезают на фрагменты 300-800 п.о. и денатурированный с одной нити. Каждый одноцепочечной ДНК-фрагмент присоединен к микробусин. Микробусин ПЦР усиливает каждый фрагмент в 2 миллиона копий в шарик. Каждый шарик помещают в микролунку на тарелке. чил часто имеют 80 секвенирования машины, работающей при один раз, каждый из которых может последовательно и анализировать до 70000 пар оснований в типичном 4-часовом беге. Это может быть достаточно быстро для прокариотического генома с 1,5 мил- лев пар оснований (20 трасс), но когда речь идет о rou- зубца последовательности больших геномов (например, 3,3-bil- лев пар оснований генома человека), еще более скорость необходима. Высокая пропускная способность секвенирования была разработана для больших геномов Первое десятилетие нового тысячелетия наблюдается быстрое развитие секвенирования высокой пропускной методы швартовке, дешевые способы последовательности и ап- alyze больших геномов. Множество различных подходов, которые используются. Как правило, они включают амплификацию ДНК-матрицы, с помощью поли- merase цепной реакции (ПЦР, см раздела 13.5), а также физического связывание матричной ДНК на твердую поверхность или крошечные шарики, называемых микрогранул. Эти Секвенирование лаборатория Флуоресцентного секвенирование оснований ДНК делается один флуоресцентная базы в то время, и читать с помощью лазерного сканера. Последовательность анализировали с помощью компьютера. Для секвенирования с массовым параллелизмом с использованием микрогранул, то да- мическая ДНК сначала разрезают на фрагменты 300- 800 пар оснований. Фрагменты денатурированные к одной нити и прикреплены к крошечным шарикам, которые являются фрагментом ДНК менее чем 20 мкм в диаметре, один (шаблон) на шарик. ПЦР используется для создания нескольких миллионов идентичной копии фрагмента на каждом шарике. Затем каждый шарик загружается в крошечный (диаметр 40 мкм) и в мульти-луночного планшет, и начинается последовательность. Автоматизированный секвенсор добавляет реакционную смесь, как один де- скрайбированных выше, но содержащий только один из четырех флуоресцентна la- Beled дНТФа. Этот нуклеотид будет стать включен в качестве первого нуклеотида в комплементарной цепи только в скважинах, где первый нуклеотид в матричной нити может пары оснований с ним. Например, если первый нуклеотид на шаблоне в скважине № 1 имеет основание T, то флуоресцентный нуклеотид с основанием A будет связываться с, что хорошо. Затем реакционная смесь удаляют и сканер захватывает изображение пластины, указание того, какие лунки содержат флуоресцентный нуклеотид. Этот процесс повторяется с диф- ferent меченого нуклеотида. Циклы машины через многие ре- торфов с использованием всех четырех дНТФ, и записи, которые игрок получает новые скважины нуклеотиды после каждого цикла. Затем компьютер идентифицирует последовательность нуклеотидов, которые были получены с помощью каждой лунки, и выравнивает фрагменты, чтобы обеспечить полную последовательность генома. Этот метод был использован для секвенирования генома Джеймса Wat- сына, codiscoverer двойной спирали ДНК. Прошло менее чем через два месяца и стоить менее $ 1 миллиона человек. Методы секвенирования в настоящее время постоянно совершенствуется, чтобы увеличить скорость и точность и снизить затраты. Геномные последовательности дают несколько видов последовательностей генома информация о новой опубликованы более и более час- тельно, создавая поток биологической информации (рис 17.4). В общем, биологи используют последовательность информации для идентификации: • открытых рамок считывания, кодирующие областей генов. Для про- Tein-кодирующих генов, эти области могут быть признаны в начале и стоп-кодоны для перевода, и интрон последовательности консенсуса, и которые указывают расположение интронов. • Аминокислотные последовательности белков, которые могут быть выведены из ДНК-последовательностей открытых рамок считывания с помощью apply- ING генетического кода (см рисунок 14.6). • Регуляторные последовательности, такие как промоторы и терминаторы для транскрипции. • гены РНК, включая рРНК, тРНК, и малых ядерных РНК (мяРНК) генов. • Других некодирующие последовательности, которые могут быть классифицированы по различным категориям, включая центромерные и теломеры регионы, Nu- четких области крепления матрицы, транспозоны и repeti- тивные последовательности, такие как короткие тандемные повторы. Информация о последовательности также используется для сравнительной геномики, сравнение вновь секвенировали геном (или их частей) с последовательностями из других организмов. Это может дать информа- ции о функциях последовательностей, и может быть использовано для отслеживания эволюционных взаимоотношений между различными организмами. 17,2 Что мы узнали из секвенирования геномах прокариот? Обратится теперь к первому организмам, последовательности были детерминированы, прокариоты, а информация этих последовательностей, предусмотренные. Когда секвенирование ДНК стало возможным в конце 1970-х годов, первые формы жизни, чтобы быть секвенированы были простейшие вирусы с их относительно небольшими геномами. Последовательности быстро новую информацию о том, как эти вирусы заражают своих хозяев и вновь продукции. Но ручные методы секвенирования, используемые на вирусы не были до задачи изучения геномов prokary- ОТЕС и эукариот. Поздние, автоматизированные последовательности технических приемов мы только что описали сделали такие исследования возможно. Теперь у нас есть геномных последовательностей для многих прокариот, к великому бла- микробиологии и медицины. Секвенирование геномов прокариот привело к новым геномики дисциплин В 1995 году команда под руководством Крейга Вентер и Гамильтон Смит опреде лили первую полную геномную последовательность свободно живущих cel- lular организма, бактерии гемофильной. Многие другие прокариотические последовательности следовали, обнажая не только то, как прокариоты распределить свои гены выполняют различные функции cel- lular, но и как их специализированные функции тся из. Вскоре мы можем даже быть в состоянии задать провокационный ставить под сомнение, что может быть минимальные требования к живой клетки. Функциональная геномика Функциональная геномика является биологической дисциплиной, которая присваивает функцию продуктов генов. Этот который сравнивает геномные последовательности из различных организмов. Ученые могут идентифицировать гены, которые присутствуют в одной бактерии и отсутствующие в другом, что позволяет им связать эти гены бактериальной функции. М. гениталий, например, испытывает недостаток ферментов, необходимых для син- thesize аминокислоты, которые E.coli и H. гриппа и обла-. Это открытие показывает, что М. гениталий должен получить все свои аминокислоты из его окружения (обычно человек urogen- итал тракт). Кроме того, E.coli имеет 55 регуляторные гены, кодирующие транскрипционные активаторы и 58 для репрессоров; М. genital- иум только 3 гены активаторов. Что такое данные говорят нам о жизни организма? Например, это biochem- ческого гибкость М. гениталий ограничивается его относительным отсутствием кон- Trol над экспрессией генов? 17,5 функциональной организации генома H. гриппа Вся последовательность ДНК имеет 1,830,137 пар оснований. Различные цвета отражают различные классы функций генов. поле, менее чем за 15 лет, в настоящее время является основным занятием биологов. Давайте посмотрим, как funtional геномика методы были применены к бактерии H.influenzae, когда его последова- тельность была известна. Единственный хозяин для H.influenzae, это люди. Он живет в (А) Некоторые последовательности ДНК могут перемещаться о геноме секвенирование генома позволило ученым изучать в более широком смысле класс последовательностей ДНК, которые были обнаружены на Генетики физиков десятилетиями ранее. Сегменты ДНК называемых мобильных элементов может перемещаться с места на место в геноме, и даже может быть вставлен в другой части ДНК в одной и той же клетке (например, плазмиды). Транспозируемого элемент может быть в одном месте в геноме одного штамма кишечной палочки, а в другом месте в годов- другого штамма. Вставки этой подвижной последовательности ДНК из других мест в геноме в середину гену кодирующих белок, который разрушает гена (рис 17.6A). Любой мРНК экспрессируется из нарушенный ген будет иметь дополнительную последовательность и транспозонов элемент верхних дыхательных путей и может привести к инфекции уха или, что более серьезно, менингит у детей. Ее сингл круг- лая хромосома имеет 1,830,138 пар оснований (рис 17,5). В дополнение к его начала репликации и гены cod- ИНГ для рРНК и тРНК, эта бактериальная хромосома имеет 1738 открытые рамки считывания с промоутерами поблизости. Когда эта последовательность была впервые объявлена, только 1007 (58 процентов) из открытых рамок считывания, кодируемых про- teins с известными функциями. Остальные 42 процентов кодируются для белков, чьи функции были неизвестны. С тех пор ученые определили многие роли этих про- teins. Например, они обнаружили гены ферментов гликолиза, брожения, и транспорта электронов. Другое A B C D E Копирование и вставка А В С D Е F Altered мРНК мРНК ДНК Если транспозонов элемент копируется и вставляется в середину другого гена, исходный ген транскрибируется в мРНК измененной. последовательностей генов код мембранных белков, в том числе тех, кто участвует в активном транспорте. Важный чик был то, что весьма заразные штаммы H.influenzae, но, не Незаразные штаммы, имеют гены поверхностных белков, которые прикрепляются бактериями в дыхательных путях человека. Эти поверхностные белки в настоящее время в центре внимания исследований (B) транспозонов элемент Другие гены транспозонов транспозонов элемент возможных методов лечения H.influenzae, инфекций. СРАВНИТЕЛЬНАЯ ГЕНОМИКА Вскоре после того, последовательность H.influenzae, была объявлена, меньшим (Mycoplasma genital- IUM; 580,073 пара оснований) и больше (E.coli; 4,639,221 пара оснований) прокариотические последовательности были завершены. Таким образом, Gan Б новая эра в биологии, что сравнительная геномика, транспозон состоит из двух элементов, фланкирующих транспонируемых другой ген или гены. Весь транспозон копируется и вставляется как единое целое. Последовательности ДНК, которые перемещаются мобильные элементы представляют собой последовательность ДНК, которые перемещаются из одного места в другое. (А) В одном способе транспозиции, последовательность ДНК реплицируется и копия вставки в другом месте в геноме. (В) Транспозонах содержат транспонируемые элементы и другие гены. Белок будет ненормальным. Так транспозонов элементы могут производить значительные фенотипические эффекты Инактивируя генов. Элементы транспозонов часто короткие последовательности пар оснований 1000-2000, и находятся на многих участках в прокариотических геном. Механизмы, которые позволяют им двигаться меняться. Например, транспозонов элемент может быть воспроизведен, а затем копия не- serted на другой сайт в геноме. Или элемент может склеить из одного места и переместить в другое место. Более длинный мобильные элементы (до 5000 пар оснований) несут гены дополни- тельных и называются транспозонами (рис 17.6B). Some- раз эти участки ДНК содержат ген устойчивости к антибиотикам. Секвенирование прокариотических и вирусных геномов имеет много потенциальных преимуществ прокариотических секвенирование генома обещает обеспечить понимание микроорганизмов, вызывающих заболевания человека. Геном-последова- quencing показал неизвестные гены и белки, которые могут быть направлены на изоляцию и функциональное исследование. Такие исследования раскрывают новые методы борьбы с патогенами и их infec- ЦИИ. Секвенирование также показало удивительные отношения между некоторыми патогенными организмами, предполагая, что гены могут быть переданы между различными штаммами. Хламидиоз вызывает наиболее распространенные венерические заболевания в Соединенных Штатах. Потому что это не- tracellular паразит, это было очень трудно учиться. Среди 900 генов несколько для синтеза АТФ с чем-то SCI-entists привыкли думать эта бактерия не может выполнить своими силами. Rickettsia prowazekii вызывает тиф; она переносится вшами и заражает людей, укушенных вшей. Из его 634 генов, 6 кодируют белки, которые имеют важное значение для вирулентности. Эти вирулентности белки используются для разработки вакцин. Микобактерии туберкулеза вызывает туберкулез. Она имеет относи- тельно большой геном, кодирующую 4000 белков. Более 250 из них используются в метаболизме липидов, так что это может быть основным способом, что эта бактерия получает свою энергию. Некоторые из его генов кодируют ранее неизвестные белки клеточной поверхности; эти белки являются мишенью для потенциальных вакцин. Streptomyces coelicolor и его близкие родственники являются источником генов для двух третей всех встречающихся в природе анти- биотиков в настоящее время используется в клинической практике. Эти антибиотики включают стрептомицин, тетрациклин и эритромицин. Последовательность генома С. coelicolor показывает 22 кластеров генов, обуслов- ливает производство антибиотика, из которых только четыре было известными ранее. Это открытие может привести к созданию новых антибиотиков для борьбы с патогенными микроорганизмами, которые эволюционировали устойчивость к антибиотикам традиционной системой. Штамм E.coli O157: H7 вызывает болезнь (иногда тяжелая), по крайней мере, 70000 человек в год в Соединенных Штатах. Его геном имеет 5416 генов, из которых +1387 отличаются от тех, в знакомых (и безвредных) лабораторных штаммов этого bac- terium. Многие из этих уникальных генов также присутствуют в других патогенных бактерий, таких как Salmonella и Shigella. Эта находка предполагает, что существует обширное изменение генетической экс среди этих видов, и что «Superbugs», которые имеют общие гены устойчивости к антибиотикам могут быть на горизонте. Тяжелый острый респираторный синдром (SARS) был впервые обнаружен в южном Китае в 2002 году и быстро распространяться в 2003 Там нет эффективного лечения и 10 процентов инфицированных людей умирают. Выделение возбудителя, вирус, и быстрое секвенирование его генома показал несколько новых белков, которые являются мишенью для возможных противовирусных препаратов или vac- Cines. Исследования ведутся на обоих фронтах, так как еще одна вспышка ожидается. Секвенирование генома также дает представление организмов не- volved в глобальных экологических циклах (см главу 58). В дополнение к хорошо известной двуокиси углерода, еще один важный газ со- tributing к атмосферному «парникового эффекта» и глобального потепления является метан (СН4; рис 2.7). Некоторые бактерии, такие как Methanococcus, производят метан в желудках коров. Другие, такие как Methylococcus, удалить метан из воздуха и использовать его в качестве источника энергии. Геномы обоих этих беньковых бактерий были упорядочены. Понимание генов, участвующих в производстве и окисления метана может помочь нам, чтобы замедлить ход глобального потепления. Метагеномика позволяет описывать новые организмы и экосистемы Если взять лабораторный курс микробиологии вы узнаете, как идентифицировать различные прокариот на основе их роста в лабораторных культурах. Например, стафилококки представляют собой группу бактерий, которые заражают кожу и носовые проходы. При выращивании на специальной среде называется кровяной агар они образуют круглые, поднятый колонии. Микроорганизмы могут быть также идентифицированы их питательными требова- ниями или условий, при которых они будут расти (например, аэробных против анаэробных). Такие способы культивирования были основой микробной идентификации для более веков, и по-прежнему полезны и важны. Тем не менее, ученые теперь могут использовать ПЦР и современные методы анализа ДНК для анализа Ми- crobes без их культивирования в лабораторных условиях. В 1985 году Норман Пейс, затем в Университете штата Индиана, придумал идею выделения ДНК непосредственно из проб окружающей среды. Он используется ПЦР для амплификации специфических последовательностей из образцов, чтобы определить, были ли конкретные микроорганизмы пред- ставляются. Продукты ПЦР секвенировали, чтобы исследовать их расходимость В городе. Термин метагеномика была придумана для описания Этого подхода анализа генов без выделения интактного организма. Теперь можно выполнить дробовик секвенирование с образцами практически из любой среды. Последовательности могут быть использованы того чтобы обнаружить присутствие известных микробов и патогенных микроорганизмов, и, пожалуй, еще присутствие ранее неизвестных организмов (рис 17.7). Например: Ружье секвенирование ДНК из 200 л морской воды показал, что он содержал 5000 различных вирусов и 2000 различных бактерий, многие из которых не было описано ранее. Один килограмма морской осадки миллиона дифрактометре ferent вирусы, большинство из них новыми. ДНК и анализ белков метагеномика Микробный ДНК, выделенную из окружающей среды могут быть усилены и проанализированы. Это привело к описанию многих новых генов и видов. • Воды стоки из шахты содержали много новых видов прокариота, процветающий в этом, по-видимому негостеприимной окру- жающей среды. Некоторые из этих организмов показали пути метаболизма, которые ранее были неизвестны биологам. Эти организмы и их возможности могут быть полезны для очистки загрязняющих веществ из воды. Эти и другие открытия действительно необыкновенные и заложена потенциальная очень важно. Подсчитано, что 90 процентов от микробного мира были невидимы для биологов и только сейчас раскрываются метагеномика. Целиком новые экосистемы бактерий и вирусов обнаруживаются в которых, рассмот PLE, один вид образует молекулу, что еще усваивает. Трудно переоценить важность такого увеличения наших знаний о скрытом мире микробов. Это познаниями край поможет нам понять природные экологические процессы, и имеет потенциал, чтобы помочь нам найти лучшие способы управления экологических катастроф, таких как разливы нефти, или удаления токсичных тяжелых металлов из почвы. Будет ли определение генов, необходимые для клеточной жизни приводит к искусственной жизни? Когда геномов прокариот и эукариот сравнивались, возникает поразительный вывод: некоторые гены присутствуют у всех организмов (универсальные генов). Существует также некоторые (почти) универсальные сегменты гена, которые присутствуют во многих генах во многих организмах; например, последовательность, которая кодирует сайт связывания АТФ. Эти данные свидетельствуют о том, что существует какой-то древний, минимальный набор ДНК последовательности, общий для всех клеток. Один из способов определить эти последовательности, чтобы искать их в компьютер скопического ГОС секвенировали геномы. Другой способ определить минимальный геном должны взять организм с помощью простого генома и намеренно мутировать один ген, в то время, чтобы посмотреть, что происходит. М. гениталий имеет один из самых маленьких известных геномов-только 482 белок-кодирующих генов. Тем не менее, некоторые из его генов необязательны при некоторых обстоятельствах. Так, например, она имеет гены для метаболизировать как глюкозу и фруктозу, но она может выжить в лаборатории на среднем кон- Taining только один из этих сахаров. А как насчет других генов? Исследователи обратились к этому вопросу с экспериментами, связанных с использованием транспозонов в качестве мутагенов. Когда транспозонов в бактерии активируются, они вставляют себя в гены случайным образом, мутирует и не- активизируя их (Рисунок 17.8). Мутантные бактерии тестировали на рост и выживаемость, а также ДНК из интересных мутантов секвенируют, чтобы выяснить, какие гены содержат транспозонов. Поразительно результат этих исследований является то, что М. гениталий может выжить в лаборатории с минимальным геномом только 382 функциональных генов! Является ли это на самом деле все, что нужно, чтобы сделать жизнеспособный организм? Эксперименты продолжаются, чтобы сделать синтетический геном, основанный на том, что М. гениталия, а затем вставить его в пустую бактериальную клетку. Если клетка начинает транскрибировать мРНК и синтез белков, фактически несостоятелен может оказаться первой жизнью, созданные людьми. В дополнении к техническому подвигу создания искусственной жизни, этот метод может иметь важные приложения. Новые микробы могут быть сделаны с совершенно новыми возможностями, такими как деградируют разливы нефти, что делает синтетические волокна, уменьшая развитие кариеса или со- инвертирующем целлюлозы в этанол для использования в качестве топлива. С другой стороны, опасения злоупотребления или неправильного обращения этих знаний не лишены оснований. Например, это может быть возможным разработать синтетические бактерии вредны для людей, животных или растений, а также использовать их в качестве агентов биологического оружия или биотерроризма. «Ge- номики джин» есть, лучше или хуже, уже из бутылки. Надеюсь, человеческое общество будет использовать его в своих интересах. РАССЛЕДОВАНИЕ LIFE Использование транспозонного мутагенеза для определения минимальной Геном Mycoplasma гениталий имеет наименьшее число генов любого прокариот. Но все его гены необходимы для жизни? Инактивируя генов один за другим, ученые определили, какие из них имеют важное значение для выживания клетки. Это исследование может привести к созданию искусственных клеток с индивидуальными геном, предназначенным для выполнения таких функций, как разлагать нефть и получение пластмасс. ГИПОТЕЗА только некоторые из генов в геноме бактерий необходимы для выживания клеток. МЕТОД Эксперимент 1 Эксперимент 2 М. гениталий имеет 482 генов; только два должны сделать эти специализированные рабочие места. Типичный вирус содержит достаточное количество ДНК закодировать лишь несколько белков-около 10000 пар оснований (п.о.). Как мы видели выше, самый простой прокариот, микоплазма, имеет несколько сотен генов, кодирующих белок-в геноме 0,5 миллиона пар оснований. Растение риса, напротив, имеет 37,544 генов. Эукариотические геном имеют более регуляторные последовательности-и многие другие регуляторные про- teins чем прокариотические геном. Большая сложность эукариот требует гораздо больше регулирования, что видно во многих точках контроля, связанного с экспрессией генов эукариот (см На рис 16,13). показано здесь. Транспозона вставляет случайным образом в один ген, инактивировать его. РЕЗУЛЬТАТЫ Неактивный ген А АВ Каждый мутант помещают в ростовую среду. Неактивный ген В Многое из эукариотической ДНК некодирующих. Распреде- лены на протяжении многих эукариотические геном различных видов ДНК-последовательностей, которые не транскрибируется в мРНК, в первую очередь интроны и последовательность генов управления. Как мы обсудим в главе 16, некоторые некодирующие последовательности транскрибируются в микроРНК. Кроме того, эукариотические геномы содержат различ- ных видов повторяющихся последовательностей. Эти fea- вания являются редкими в прокариот. Эукариот имеют несколько хромосом. Геномная «энциклопедия» из эукариота разделяется на нескольких Каждой хромосому должна иметь, как минимум, три определяющие последовательности ДНК, которые мы описали в предыдущих главах «том.»: Происхождение репликации (Ori), который распознаются ДНК техник репликации; Рост центромеры означает, что ген А не является существенным. Никакой рост не означает, что ген B является существенным. область, которая содержит скопированную хромо- Сомс вместе до митоза; и последовательность Meric telo- на каждый конце хромосферы Заключения Если каждый ген инактивируется в своей очереди, «минимально необходимый геном» может быть определен. Перейти к yourBioPortal.com оригинальных цитат, обсуждения и соответствующие ссылок для всех следственных фигур жизни. некоторые из которых поддерживает целостность хромосом. Модельные организмы показывают многие характеристики эукариотических геномов Большинство уроков, извлеченных из эукариотических достижениям в области секвенирования и анализа ДНК привели к быстрому секвенирования геномов эукариот. Обратимся теперь к результатам этих анализов. геномы пришли из нескольких простых модельных организмов, которые были изучены экстенсивно: дрожжей Saccharomyces CEREVISIAE, нематоды (аскариды) Caenorhabditis Элеганс, плодовой мухи дрозофилы, и-представляющих растения-на-Тале 17.3 Что мы узнали из секвенирования геномах эукариот? кресс, Резуховидка Таля. Модельные организмы были выбраны потому, что они относительно легко расти и учиться в лаборантом, их генетика хорошо изучены, и они проявляют характери- Как геномы были упорядочены и описаны несколько основных различий возникли между эукариотической и прокариотической геномы (таблица 17.1). Основные отличия включают в себя: эукариотических геномов больше, чем у прокариот, и они имеют больше белок-кодирующих генов. Это различие не удивительно, учитывая, что многоклеточные организмы имеют много типов клеток со специфическими функциями. Многие белки необходимы стики, которые представляют собой большую группу организмов. Дрожжи: ОСНОВНЫЕ эукариотических МОДЕЛЬ Дрожжи одноклеточные эукариоты. Как и большинство эукариота, у них есть мембрана-ен- закрыты органеллы, такие как ядро ​​и эндоплазматический ретикулум люм и жизненный цикл, который чередуется между гаплоидными и диплоидными поколениями (рис 11.15). Mb = миллионы пар оснований В то время как прокариот E.coli, имеет одну круговую хромосому с примерно 4,6 млн п.н. и 4290 белок-кодирующих генов, bud- динь дрожжей (Saccharomyces CEREVISIAE) имеет 16 линейных хромосом и гаплоидный содержанием более 12,5 млн п.о., с 5770 белок-кодирующих генов. инактивации генов исследования, аналогичные проведены для M. гениталий (смотри рисунок 17.7) показывают, что менее 20 процентов этих генов имеют важное значение для выживания. Самое поразительное различие между геном дрожжей и что кишечной палочки в количестве генов для нацеливания белков органелл (таблица 17.2). Оба эти одноклеточные организмы AP- груши использовать примерно то же число генов выполнять основные функции выживания клеток. Это компартмент Ментализация эукариотической клетки дрожжей в или-ganelles, что требует его иметь много больше генов. Эта находка является прямым, количественное подтверждение чего-то мы знали в течение века: эу- karyotic клетка структурно более сложным, чем прокариотической клетки. Нематоды: ПОНИМАНИЕ эукариотических VELOPMENT В Де- 1965 Сиднея Бреннера, свежая, являясь частью команды, которая первый изолированным мРНК, искали простой организм, в котором для изучения многоклеточности. Он остановился на Caenorhabditis возвел Ганс миллиметр длиной нематода (аскариды), который обычно живет в почве. Она также может жить в лаборатории, где она стала любимой моделью организма биологов развития (смотрите раздел 19.4). Нематода имеет прозрачное тело, которое развивается в течение 3-х дней от оплодотворенного яйца до взрослого червя, составленного из почти 1000 ячеек. Несмотря на небольшое количество клеток, нематода имеет нервную систему, переваривает пищу, размножается половым путем, и возраст. Так что не удивительно, что интенсивные усилия для секвенирования генома этого модельного организма. C. Элеганс генома (100 миллионов пар оснований), в восемь раз больше, чем у дрожжей и имеет 3,5 раза больше белок-кодирующих генов (19,427). инактивация гена исследования показали, что вирус может выжить в лабораторных культурах только 10 процентов этих генов. Таким образом, «минимальный геном» червя примерно в два раза больше, что дрожжи, которые в свою очередь, в четыре раза превышает размер минимального генома микоплазмы. Что эти дополнительные гены делают? Все клетки должны иметь гены для выживания, роста и деления. Кроме того, клетка многоклеточных организмов должна иметь гены для проведения клетки вместе с образованием ткани, для дифференцировки клеток, а также для межклеточной коммуникации. Глядя на таблицу 17.3, вы распознаете функции, которые мы обсуждали в предыдущих главах, в том числе регуляции генов (смотри главу 16) и клеток communi- катиона (см главу 7). Дрозофилы: ОТНОСЯЩИЕСЯ Генетики геномика плодовой мушки дрозофилы является известной моделью организован- изма. Исследования плодовой мушки генетики привело к разработке многих основных принципов генетики (см раздел 12.4). Более 2500 мутаций дрозофилы была описана в 1990-е годы, когда началась секвенирование генома, и сам этот факт был хорошим поводом для секвенирования ДНК плодовой мухи. Плодовая муха гораздо больше, чем организм C. Элеганс, и в размере (он имеет в 10 раз больше клеток) и сложность, и она подвергается сложная разработ- ментальных преобразований из яйца до личинки в куколку взрослого. Не удивительно, что геном мухи (около 123 млн пар) больше, чем у C. Элеганс. Но, как мы уже упоминали ранее, размер генома не обязательно коррелирует с количеством генов, закодированных. В этом случае, чем больше плодовая мушка геном содержит меньше генов (13,379), чем меньший нематод генома. На рис 17.9 приведены функции генов Drosophila, которые были охарактеризованы до сих пор; это распределение является типичным для сложного эукариота. ARABIDOPSIS: ИЗУЧЕНИЕ геномы растений около 250 000 видов цветковых растений преобладают земли и свежей воды. Но в контексте истории жизни, цветущие растения довольно молоды, эволюционировали лишь около 200 миллионов лет назад. Геномы некоторых растений огромны, например, геном кукурузы составляет около 3 млрд пар оснований, и что из пшеницы 16000000000 пар. Таким образом, хотя мы, естественно, больше всего заинтересованы в геномах растений, которые мы используем в качестве пищи и волокна, это не удивительно, что ученые впервые выбрали более простую последовательность цветущего растения. Резуховидка Таль, Тале кресс, является членом семейства горчицы и давно любимая модель организм растений би- ologists. Это небольшие (сотни могли расти и размножаться в пространстве, занимаемом этой страницы) и легко манипулировать, и имеет относительно небольшой (115000000 п.о.) генома. Функции генома эукариот Распределение функций генов в дрозофилы показывает шаблон, который является типичным для многих сложных организмов. Arabidopsis геном имеет около 28 000 белок-кодирующих генов, но, на удивление, многие из этих генов являются дубликатами, и, вероятно, произошло от хромосомных перестроек. Когда эти повторяющиеся гены вычитают из общего числа, около 15000 уникальных генов левой сходны с номерами генов, найденных в плодовых мух и нематод. Действительно, многие из генов, обнаруженных у этих животных имеют гомологи (гены с очень похожими последовательностями) в Arabidopsis и других растениях, предполагая, что растения и животные имеют общий предок. Но Arabidopsis имеет некоторые гены, которые отличают его как растение (таблица 17,4). Они включают в себя гены, участвующие в процессе фотосинтеза, в транспорте воды в корень и по всему растению, в сборке клеточной стенки, в поглощении и метаболизме неорганических веществ из окружающей среды, а также в син- диссертации специфических молекул используются для защиты от микробов и травоядных (организмы, которые питаются растениями). Эти молекулы обороны растений могут быть одной из основных причин, почему число генов, кодирующих белок-в растениях выше, чем у животных. Растения не могут убежать от своих врагов или другие неблагоприятные условия, как животные могут, и поэтому они должны справиться с ситуацией, когда они находятся. Таким образом, они делают десятки тысяч молекул, чтобы бороться с врагами и адаптации к окружающей среде (см главу 39). Эти растительные специфические гены также найдены в геномах других растений, в том числе риса, первой крупной сельскохозяйственной культуры, чьи последова- тельность была определена. Рис (Oryza Sativa) является наиболее важной культурой в мире; он является одним из основных в рационе 3 миллиарда человек. Больше генома риса имеет набор генов удивительно, аналогичную Arabidopsis. Совсем недавно геном тополя, Populus trichocarpa, секвенировали, чтобы получить представление о потенциале для этого быстро растущего дерева, которые будут использоваться в качестве источника фиксированного углерода для изготовления топлива. Сравнение трех геномов показывает, что многие гены в общем, содержащие основной геном растения (рис 17.10). Эукариоты имеют генные семьи Около половины всех эукариотических белок-кодирующих генов существуют как только одну копию в гаплоидный геном (две копии в соматических клетках). Остальные присутствуют в большом количестве копий, которые возникли из генных дупликаций. В течение эволюционного времени, различные копии генов претерпели отдельные мутации, порождая группы близкородственных генов, называемых генных семейств. Некоторые семейства генов, таких как гены, кодирующие глобина белки, которые составляют гемо- глобина, содержат лишь несколько членов; другие семьи, такие как гены, кодирующие иммуноглобулины, которые составляют анти- тела, сотни членов. В человеческом геноме, D ε Gγ Aγ ψβ1 δ β 17.11 глобина гены Семейство α-глобина и бета-глобина кластеры человеческого семейства генов глобина расположены на разных хромосомах. Гены каждого кластера отделены друг от друга некодирующих «спейсер» ДНК. В нефункциональных псевдогенах обозначены греческая буква пси (ф). Ген γ имеет два варианта, Aγ и Gγ. Геномов растений Три растительные геномы имеют общий набор приблизительно 21 000 генов, которые, как представляется, содержат «минимальный» растительный геном. Есть 24,000 белок-кодирующих генов, но 16,000 различных семейства генов. Таким образом, только одна треть из человеческих генов являются уникальными. Последовательности ДНК в семействе генов обычно отличаются друг от друга. До тех пор, по меньшей мере, один элемент кодирует функциональный белок, другие члены могут мутировать таким образом, чтобы изменить функцию белков, они кодируют. Для эволюции, наличие нескольких копий гена позволяет селек- ции мутаций, которые обеспечивают преимущества при определенных обстоятельствах. Если мутантный ген является полезным, он может быть выбран для успеш- в ceeding поколений. Если мутантный ген является полной потерей, функциональная копия все еще там выполнять свою роль. Семейства гена, кодирующие глобинов является хорошим примером семейств генов, обнаруженных у позвоночных. Эти белки найдены в гемоглобина и миоглобина (кислород-связывающий белок пред- ставляются в мышцах). Глобина гены все возникли давно от одного общего предкового гена. В организме человека существуют три функциональные члены альфа-глобина кластера и пять в бета-глобина кластера (рис 17.11). У взрослых, каждая молекула гемоглобина представляет собой тетрамеры, содержащие два идентичных альфа-глобина субъединиц, два идентичных бета-глобина субъединицы, и четыре гема пигменты (рис 3.10). В процессе развития человека, различные члены кластера генов глобина выражены в разное время и в разных tis- ГУП. Это выражение дифференциальной ген имеет большое физиологическое ное значение. Так, например, гемоглобин, содержащие гамма-глобина, суб- блок, найденный в гемоглобине плода человека, связывает O2 более плотно, чем у взрослого гемоглобин делает. Это специализированная форма гемоглобина гарантирует, что в плаценте, O2 будет переведен из крови матери в кровь развивающегося плода. Только рождение носовой Бе печень перестает синтезировать фетальный гемоглобин и клетку костного мозга взять на себя, делая взрослые формы (2Л и 2р). Таким образом гемоглобины с различными аффинностями связывания для O2 кия на разных стадиях развития человека. В дополнение к генов, которые кодируют белки, многие ген fami- ложь включают нефункциональные псевдогенов, которые обозначены с греческой буквы фунтов на квадратный дюйм (ф) (рис 17.11). Эти гены псевдоэнергий в результате мутаций, которые вызывают потерю функции, а не повышенная или новую функцию. Последовательность ДНК псевдогена не может сильно отличаться от других членов семьи. Он может просто не хватает промотор, например, и, следовательно, не будут расшифрованы. Или это может не иметь сайт узнавания, необходимый для удаления интрона, так что транскрипт он делает не правильно переработан в полезный зрелой мРНК. В некоторых семействах генов псевдогены превышают число функциональных генов. По- сколько некоторые члены семей функциональны, как представляется, мало давления отбора для удаления псевдогенов. Эукариотические геном содержат много повторяющихся последовательностей эукариотических геномов содержат многочисленные повторяющиеся последовательности ДНК, которые не кодируют полипептиды. Они включают в себя высоко повторяющиеся последовательности, умеренно повторяющиеся последовательности и транспозоны. Высоко повторяющиеся последовательности короткие (менее 100 п.о.) последовательностей, которые повторяются тысячи раз в тандеме (бок о каждом конкретном сторона) механизмов в геноме. Они не расшифрованы. Их доля в эукариотических геном варьирует, от 10 процентов в организме человека до примерно половины генома у некоторых видов плодовых мух. Часто они связаны с гетерохроматином, плотно упаковано, транскрипционно неактивной частью генома. Другие высоко повторяющиеся последовательности разбросаны по всему геному. Например, короткие тандемные повторы (STRs) 1-5 пар оснований может повторяться до 100 раз в конкретном хромосоме. Номер копии STR в определенном месте варьируется между индивидуумами и наследуется. В главе 15 мы опишем, как СПО могут быть использованы при идентификации лиц (ДНК-дактилоскопии). Умеренно повторяющиеся последовательности повторяются 10-1000 раз в геноме эукариот. Эти последовательности включают в себя гены, которые транскрибируются для получения тРНК и рРНК, которые используются в синтезе белка. Клеток делает тРНК и рРНК постоянно, но даже при максимальной скорости транскрипции, насадных копии генов тРНК и рРНК будет недостаточно для снабжения больших количеств этих молекул, необходимых в большинстве клеток. Такой геном имеет множественные копии этих генов. У млекопитающих четыре разных молекул рРНКов составляют RI- bosome: в 18S, 5.8S, 28S и 5S рРНК. (Индекс S обозначает единицу Сведберга, который является мерой размера.) В 18S, 5.8S и 28S рРНК транскрибируются вместе в виде одной молекулы РНК-предшественник (рис 17.12). В результате нескольких posttranscrip- ционных стадий, предшественник разрезают на последних трех рРНК про- дуктов, и РНК некодирующей «спейсер» отбрасывается. Последовательность, кодирующая этот РНК умеренно повторяющаяся в организме человека: в общей сложности 280 копий последовательностей расположены в кластере тров на пять разных хромосомах. Транспозонов Помимо генов РНК, наиболее умеренно повторяющиеся последовательности не стабильно интегрированы в геном. Вместо этого, эти последовательности могут перемещаться с места на место, и, таким образом, называют транспонируемых элементы или транспозонов. Prokary- РИМЕЧАНИЯ также транспозоны (смотри рисунок 17.6). Транспозоны составляют более 40 процентов генома человека и около 50 процентов генома кукурузы, хотя процент меньше (3-10 процентов) во многих других эукариотов. Есть четыре основных типа транспозонов в эукариот: SINEs (короткие чередующиеся элементы) до 500 пар оснований в длину и транскрибируются, но не переводятся. Есть около 1,5 миллиона из них разбросаны по геному человека, что составляет около 15 процентов от общего содержания ДНК. Один типа, 300 п.н. элемента Alu, составляет 11 процентов генома человека; он присутствует в миллион экземпляров. LINES (длинные чередующиеся элементы) до 7000 пар оснований, а некоторые из них расшифрованы и переведены в белки. Они составляют около 17 процентов генома человека. 18S 5.8S 28S рРНК Pre-транскрипт рРНК SINEs и LINES перемещаться по геному в своеобразно: они транскрибируются в РНК, которая затем действует в качестве шаблона для новой ДНК. Новая ДНК становится вставляются в новом месте в геноме. Это «скопировать и вставить» mech- результаты ханизм в двух экземплярах: один транспозонов в исходном месте, а другой на новом месте. Ретротранспозоны также делают РНК копии себя, когда они перемещаются по геному. Некоторые из них кодируют белки, необходимые для их собственной транспозиции, а другие нет. SINEs и линий типа ретротранспозоны. Non-СИНЕ, не- ретротранспозоны ЛИНИЙ составляют около 8 процентов генома человека влажности от. ДНК-транспозонов не используют промежуточных РНК. Как и некоторые прокариотические заменяемые элементы, они вырежут из исходного местоположения и стать вставлены в новом месте пройти без тиражируются. Какую роль эти движущиеся последовательности играют в клетке? Лучший ответ до сих пор, кажется, что транспозонов просто cel- lular паразиты, которые могут быть воспроизведены. Вставка транс- poson на новом месте может иметь важные последствия. Например, вставка транспозона в кодирующей области гена приводит в мутации (см рисунок 17.8). Это явление объясняется несколько редких форм некоторых генетических заболеваний у мужчин, влажностей от включая гемофилию и мышечную дистрофию. Если не- sertion из транспозонов происходит в зародышевой линии, гаметы с новыми результатами мутации. Если вставка происходит в SO- чески клетки, может привести к раку. Иногда соседний ген может быть repli- лаборанта вместе с транспозоном, в результате дупликации генов. Транспозон может нести ген или его часть, на новое место в геноме, перетасовки генетического материала и создание новых генов. Очевидно, что транспонирование мешает генетический горшок в геноме эукариот и, таким образом, способствует генетической изменчивости. Раздел 5.5 описывает теорию endosym- BIOSIS, которая предлагает, что хлоропласты и Ми- tochondria являются потомками некогда свободных liv- щего прокариота. Транспозоны могут сыграть определенную роль в эндосимбиозе. В живых эукариотов хлоропласты и митохондрии содержат некоторое количество ДНК, но ядро ​​содержит большинство генов (В) Умеренно повторяющихся последовательности кодов для рРНКа (A) Этого гена рРНКа, наряду с его нетранскрибируемой спейсерной областью, повторяется 280 раз в человеке генома, с кластерами на пять хромосом Somes. (B) Этот электронно-микроскопический снимок показывает transcrip- ции множественных генов рРНК. Последовательности в геноме эукариот Есть много типов ДНК-последовательностей. Некоторые из них расшифрованы, и некоторые из этих последовательностей переведены. - - + - - - + + + Промоутеры и выражение Трансляции Переведенный, которые кодируют белки, органелл. Если органеллы когда-то были независимы, они должны изначально иметь Вошедший все эти гены. Как гены двигаться к ядру? Они, возможно, сделали так транспозиции ДНК между органеллами и ядром, которые до сих пор имеют место to-день. ДНК, которая остается в органеллах могут быть остатками более полных геном прокариота. Смотрите рисунок 17.13 для резюме различных типов последовательностей в геноме человека. Анализ геномов эукариот привел огромное количество полезной информации, как мы уже видели. В следующем полураме мы более внимательно посмотреть на геном человека. управляющие последовательности интронов экзоны Высоко повторяющихся коротких последовательностей рРНК и генов тРНК транспозоны SINEs линий Ретротранспозоны ДНК • Из 3,3 млрд пар оснований в гаплоидный геном человека, менее чем 2 процента (около 24 000 генов) составляют белок-кодирующие области. Это было неожиданностью. Перед секвенирование быть- ган, люди были оценены, исходя из разнообразия их белков, чтобы иметь 80,000-150,000 гены. Фактическое число генов-не много больше, чем в плодовой мушки-означает, что посттранскрипционные механизмы (такие как альтернативный splic- ING) должны учитывать наблюдаемое количество белков в организме человека. То есть, средний ген, человек должен кодировать несколько разных белков. • Средний ген имеет 27000 пар оснований. Размеры генов сильно различаются, от примерно 1,000 до 2,4 миллиона пар оснований. Изменение размера гена следует ожидать, учитывая, что человеческие белки (и РНК) различаются по размеру, от 100 до примерно 5000 аминокислот в полипептидной цепи. • Практически все человеческие гены имеют много интронов. • Более 50 процентов генома состоит из транспозонов и других высокоразвитых повторяющихся последовательностей. Повторяющиеся последовательности генов вблизи GC-богатых, в то время как те, дальше от генов АТ-богатых. 17,4 Каковы характеристики генома человека? • Большая часть генома (около 97 процентов) одинакова во всех ПЭО PLE. Несмотря на кажущуюся однородность, есть, конечно, К началу 2005 года были завершены первые последовательности генома человека, на два года раньше запланированного срока и хорошо в рамках бюджета. Опубликованные последовательности, один произведенный в рамках проекта публично генома человека, а другая частной ком- пания, были гаплоидные геном, которые были составлены из нескольких людей. С 2005 года диплоидных геномов нескольких лиц, которые были упорядочены и опубликованы. Последовательность генома человека провела несколько сюрпризов Ниже приводится лишь некоторые из интересных фактов, которые мы узнали о геноме человека: многие индивидуальных различий. Ученые сопоставили более 7000000 одиночных нуклеотидных полиморфизмов (SNP) в организме человека. • Гены не равномерно распределены по геному. Хроматографе mosome 19 упакован плотно с генами, в то время как некоторые хромо- 8 имеют длинные отрезки без кодирующих областей. У хромосома имеет наименьшее количество генов (231), в то время как хромосома 1 имеет наибольшее (2,968). Сравнения между секвенсированными геном из prokary- ОТЕСА и эукариота выявили некоторые из эволюционного ре- lationships между генами. Некоторые гены присутствуют в обоих прокариот и эукариот; другие только в эукариот; третьи только у животных, или только у позвоночных (рис 17.14). 17,4 | Каковы особенности генома человека? 381 Увеличение сложности иммунной системы Нервные systemVertebrates только 22% Позвоночные животных и только 24% Функции, необходимые для жизни Все прокариоты и эукариоты 21% эукариот только 32% Клеточные отсеков многоклеточность слово в предложении. Анализ гаплотипов у людей со всего мира показали, что существует не более 500000 распространенных вариаций. Генотипирование ТЕХНОЛОГИЯ И персональная геномика новых технологий также гии постоянно разрабатываются для анализа тысяч или миллионов полиморфизмов в геномах людей. Такие тех- гий включают быстрые способы секвенирования ДНК и микро- массивы, которые зависят от ДНК-гибридизации для выявления конкретной SNPs. Так, например, микрочип 500000 ОНПА были использованы для анализа тысяч людей, чтобы выяснить, какие ОНП связаны с конкретными заболеваниями. Цель состоит в том, чтобы соотнести СНП-определенный гаплотип с болезненным состоянием. Объем данных развития Эволюция генома Сравнение человеческого и других геномов показал, как гены с новыми функциями, которые были добавлены в течение эволюции. Каждый процент число относится к генам в геноме человека. Таким образом, 21 процентов человеческих генов имеют гомологи у прокариот и эукариот других, 32 процента человеческих генов происходят только в других эукариот, и так далее. Более сравнительная геномика теперь, что геномы двух других приматов, шимпанзе и резус макаки, ​​которые были секвенированы возможно. Шимпанзе является evolution- arily близко к людям, и акций 95 процентов последовательности генома человека. Более отдаленное отношение макак резус акций 91 процентов человеческой последовательности. Поиск по для набора генов человека, которые отличаются от других приматов, и «делают человек человеком.» Человеческая геномика имеет потенциальные преимущества в медицине Комплексных фенотипов определяются не отдельными генами, а многие гены, взаимодействующих с окружающей средой. В однофазных моделях аллель ФКИ и серповидно-клеточной ane- Mia (см главу 15) не применяются к таким распространенным заболеваниям, как диабет, болезнь сердца и болезнь Альцгеймера. Для того, чтобы понять генетические основы этой разноголосицы Облегчает, биологи теперь используют быстрые технологии генотипирования для создания «гаплотипы карты», которые есть чудовищный: 500000 ОНПА, тысячи людей, тысячи медицинских записей. С таким большим количеством естественного изменением, статистические показатели связи между гаплотипом и болезнями должны быть очень строгими. Эти ассоциативные тесты выявили определенные гаплотипы или аллель, которые связаны с умеренно повышенным риском для таких заболеваний, как рак молочной железы, диабет, артрит, ожирение и ишемическая болезнь сердца (рис 17.15 и таблица 17.5). Частные компании теперь будут сканировать человеческий геном для этих variants- и цена за эту услугу продолжает получать меньше. Однако, на данный момент неясно, что человек без симптомов следует делать с информацией, так как многочисленные гены, влияние окружающей среды, а также эпигенетические эффекты вносят свой вклад в развитие конфликтного этих заболеваний. Конечно, лучший способ для анализа генома человека является на самом деле секвенирования. До недавнего времени это было непозволительно дорогостоящим. Как мы уже упоминали ранее, геном стоимость пионера ДНК Джеймса Уотсона более $ 1 миллиона, конечно, слишком много для типичного пред- приятием или страховой компании, получая в контексте медико-санитарной помощи. Но с развитием технологий секвенирования стоимость является сни быстро Инг. Один новый метод автоматически последовательности, кодирующие белки-экзоны только, например. После того, как стоимость генома quencing-последова- находится в пределах доступного диапазона, тестирование SNP будет заменено. Каждый бар представляет собой SNP. Есть много тысяч полиморфизмов в геноме человека. используется для идентификации ОНП (произносится «надрезы»), которые связаны с генов, вовлеченных в заболевание. Гаплотип КАРТОГРАФИРОВАНИЕ ОНП, которые различаются между отдельными лицами, не наследуется как самостоятельные аллели. Скорее всего, набор SNP, которые присутствуют на участке хромосомы, как правило, наследуется как единое целое. Это связано часть хромосомы называется гаплотип. Вы можете думать о гаплотипе в качестве предложения и SNP как SNP профиля у людей с заболеванием профилем ДНК SNP у людей без заболевания SNP генотипировании и Scanning Disease геном людей с и без особых заболеваний показывает корреляцию между ОНПОМ и комплексом заболевания. Сравнение профилей показывает ОНП, которые коррелируют с болезнью. Изучение того, как геном человека влияет на его или ее ответ на лекарства или другие внешние агенты называют фармако- геномика. Этот тип анализа позволяет предсказать, будет ли препарат эффективным. Цель состоит в том, чтобы персонализировать медикаментозное лечение, так что врач может знать заранее, будет ли человек пользу от конкретного препарата (рис 17,16). Этот подход также может быть использован, чтобы уменьшить частоту побочных реакций пути выявления лиц, которые будут Me- tabolize препарата медленно, что может привести к опасно высокому уровню препарата в организме. Pharmacogenomics Генетическая изменчивость может повлиять двутавровойn- делимый отвечает на конкретный препарат. Например, лекарственное средство может быть химически модифицировано в печени, чтобы сделать его более или менее оценку активным. Рассмотрит фермент, который катализирует следующую реакцию: активное лекарственное средство → менее активный препарат мутация в гене, который кодирует этот фермент может сделать фермент менее активным. Для заданной дозы препарата, люди с мутацией будет иметь более активный препарат в крови, чем человек без мутации. Таким образом, эффективная доза препарата будет ниже в этих людях. Теперь рассмотрим другой случай, в котором фермент печени необходима, чтобы сделать препарат активен: неактивный препарат → активный препарат Лицо, несущий мутацию в гене, кодирующем этот печени ен- Секвенирование генома имел большой успех в продвижении biolog- скую понимание. Высокая пропускная способность технологии теперь ходятся применительно к другим компонентам клетки: белков и метаболитов. Обратимся теперь к результатам этих исследований. Zyme не будет зависеть от лекарственного средства, так как активирующий ен- Zyme нет. 17,5 Что ли новые Дисциплины протеомики и Метаболомика Reveal? У всех пациентов с таким же диагнозом «Геном человека является книга жизни.» Заявления, как это были распространены в то время, последовательность генома человека была впервые выявлено. Они отражают «генетический детерминизм», что фенотип человека определяется его генотипом. Но это или- ganism только продукт экспрессии гена? Мы знаем, что это не так. Белки и малые молекулы, присутствующие в любой клетке в данный момент времени отражают не только экспрессию генов, но модие катионы от внутриклеточной и внеклеточной среды. Два новых месторождения появились в дополнение к геномике и принять более полный снимок клетки и организма-протеомики и метаболомике. Эти пациенты либо не реагируют на лекарства или страдать побочные эффекты. Они нуждаются в альтернативном препарате или дозе. Эти пациенты имеют гены для эффективного ответа на препарат. Протеом является более сложным, чем геном Как упоминалось выше, многие гены кодируют более чем одного белка (рис 17.17A). Альтернативный сплайсинг приводит к различным комбинациям экзонов в зрелом мРНКе транскрибируется с одного гена (рис 16,22). Посттрансляционные модификации также увеличивают количество белков, которые могут быть получены из одного гена (рис 14,22). Протеое это сумма из Pharmacogenomics Корреляции между генотипами и ответами к лекарственным препаратам поможет врачам разработать персонифицированную медицинскую помощь. белки, продуцируемые организмом, и это является более сложным, чем его геном. (A) ДНК 17,5 | ЧТО НОВОГО ДИСЦИПЛИНЫ протеомика и метаболомики ПОКАЗАТЬ? 383 экзона интрона мРНК 1 Альтернативного сплайсинга может производить различный мРНК ... 17.18 Белок эукариот Протеого Около 1300 белков являются общими для всех эукариот и попадают в эти категории. Хотя их аминокислотные последовательности, могут отличаться в ограниченной степени, они выполняют второе отделение (размер) (B) одни и те же основные функции во всех эукариот. Во-первых разделение (зарядка) Протеомика (A) один ген может кодировать для нескольких белков. (В) белки клетке могут быть разделены на основе заряда и размера с помощью двумерного гель-электрофореза. Два разделения может отличить большинство белков друг от друга. Два методы обычно используется для анализа протеых: • Из-за их уникальные композиции аминокислот (первичные структуры), большинство белков имеют уникальные комбинации электрического заряда и размера. На основании этих двух СВОЙСТВ, они могут быть разделены с помощью двумерной гелевой электростатическое trophoresis. Таким образом, изолированные, отдельные белки могут быть проанализированы, секвенируют, и изучены (рис 17.17B). • Масс-спектрометрия использует электромагниты для идентификации белков с помощью масс их атомов, и отображает их в виде пиков на графике. Конечная цель протеомики является столь же амбициозна, как и геномика. В то время как геномика стремится описать геном и его экспрессию, протеомика стремится идентифицировать и охарактеризовать все выраженные белки. Сравнения протеомов человека и других организмов eukary- ушных выявили общий набор белков, которые могут быть разделены на группы со сходными аминокислотными последовательностями и аналогичными функциями. Сорок шесть процентов дрожжевого протеома, 43 процентов червячного протеома, и 61 процентов от мух протеома разделяют протеом человека. Функциональный скопический SES показывает, что этот набор белков 1300 обеспечивает основные функции метаболических из эукариотической клетки, такие как гликолиз, цикл лимонной кислоты, мембранный транспорт, синтез белка, ДНК repli- катион, и так далее. (Рисунок 17.18). Конечно, это не единственные человеческие белки. Есть еще много, которые предположительно отличают нас как человек eukary- ушные организмы. Как мы уже отмечали ранее, белки имеют дифрактометр ferent функциональных участков, называемые доменами (например, домен для связывания субстрата, или домен для охватывающей мембраны). В то время как конкретный организм может иметь множество уникальных белков, эти белки часто просто уникальные комбинации областей, которые существуют в других организмах. Эта перестановка генетической колоды является ключом к эволюции. Метаболомика является изучение химического фенотипа Изучение генов и белков дает ограниченное представление о том, что происходит в клетке. Но, как мы уже видели, как функция гена и функции белка зависят от внутренних и внешних факторов окружающей ronments клетки. Многие белки являются ферментами и их Ac- tivities влияют на концентрацию субстратов и про- дуктов. Так как изменения протеома, так будет Содержания этих часто малых молекул, называемых метаболитов. Метаболизируемый Lome является количественным описанием всех малых молекул в клетке или организме. Они включают в себя: первичные метаболиты, участвующие в нормальных процессах, такие как промежуточные продукты в пути, как гликолиз. Эта категория также включает в себя гормоны и другие сигнальные молекулы. Вторичные метаболиты, которые часто являются уникальными для отдельных организмов или групп организмов. Они часто участвует в специальных ответы на окружающую среду. Примерами являются ап- tibiotics из микробов, и многие химические вещества из растений, которые используются для защиты от патогенных микроорганизмов и травоядных. Не удивительно, что измерения метаболитов включает изощренные аналитические инструменты. Если вы изучали органическую или ана- lytical химии, вы можете быть знакомы с газовой хроматографии и высокоэффективной жидкостной хроматографии, который отдельные молекулы, а также масс-спектрометрии и ядерная магнито- нитные резонансной спектроскопии, которые используются, чтобы идентифицировать их. Эти измерения в результате «химические» снимки клеток или организмов, которые могут быть связаны с физиологическими состояниями. Там был достигнут некоторый прогресс в определении человеческого Метаболом. База данных, созданная Дэвидом Wishart и коллектив- лиг в Университете Альберты содержит более 6500 метаболизируемые облегчённые записей. Теперь задача состоит в соотносить уровни этих веществ к физиологии. Например, вы, вероятно, знаете, высокие уровни глюкозы в крови связаны с диабетом. Но что на ранних стадиях болезни сердца? Там может быть закономерно- крачка метаболитов, что является диагностика этого заболевания. Это может помочь в ранней диагностике и treatment.Plant биологи далеко впереди медицинских исследователей в изучении метаболомики. На протяжении многих лет, десятки тысяч втор- вторичны метаболитов были идентифицированы в растениях, многие из них сделаны в ответ на экологические проблемы. Некоторые из них описаны в главе 39. Метаболом модельного организма Резуховидка Таля, что описывается, и даст понимание того, как растение справляется с напряжениями, таких как засуха или атаки патогена. Это знание может быть полезным в опти- мальных роста растений в сельское хозяйство. Глава РЕЗЮМЕ Как ли геном Sequenced? 17.3 Что мы узнали из Секвенирование Секвенирование геномов требуется разработка способов сократить большие хромосомы на фрагменты, последовательность каждого из фрагментов, а затем выравнивают их на хромосоме. Обзор Рисунок 17.1, 17.1 ОЖИВЛЕННАЯ Учебник Иерархическая последовательность включает в себя отображение генома с генетическими маркерами, резка геном на более мелкие куски и секвенирование их, а затем выстраиваются в последовательности с использованием маркеров. Ружье последовательность включает в себя непосредственно разрезания генома на перекрывающиеся фрагменты, секвенирование их, и с помощью вычислимости эр, чтобы выстроить последовательности. Секвенирования ДНК технологии включают меченые нуклеотиды, которые оканчиваются растущую цепь полинуклеотид. Обзор Рисунок 17,2 Rapid, разрабатываются автоматизированные методы для высокопроизводительного секвенирования. Обзор Рисунок 17.3, ANIMATED Учебник 17,2 Что мы узнали из секвенирования геном прокариота? Секвенирование ДНК используется для изучения геномов прокариот, которые являются важными для человека и экосистем. Функциональная геномика является определение функций генных продуктов. Сравнительная геномика предполагает сравнение генов и геномов разных организмов, чтобы определить ком- особенности и функции пн. Транспозонов элементы и транспозоны могут перемещаться по геному. Обзор Рисунок 17.6 метагеномика является определение ДНК-последовательностей без первого изолирующих, растет и идентификации организмов, присутствующих в образце окружающей среды. Многие из этих последовательностей из прокариота, которые были до сих пор неизвестны биологов. Обзор Рисунок 17.7 Транспозонный мутагенез может быть использован для инактивации генов один за другим. Тогда организм может быть проверен на выживание. Таким образом, минимальный геном менее чем 350 генов был определен для бактерии Mycoplasma гениталий. Обзор Рисунок 17,8 геномах эукариот? Геномные последовательности из модельных организмов показали некоторые общие черты генома эукариот. Кроме того, существует специализированные гены клеточной компартментации, развитие и особенности уникальной для растений. Обзор Таблицы 17.1-17.4 Цифры и 17.9 и 17.10 некоторых эукариотических генов существуют как члены семейств генов. Белки могут быть сделаны из этих близкородственных генов в разное время и в различных тканях. Некоторые члены семейств генов могут быть нефункциональные псевдогенами. Повторные последовательности присутствуют в геноме эукариот. Умеренно повторяющиеся последовательности включают в себя гены, кодирующие рРНК. Обзор Рисунок 17,12 Каковы характеристики генома человека? Гаплоидный геном человека имеет 3,3 млрд пар оснований. Только 2 процента генома кодирует белки; остальные кон- повторяющихся будут устранены последовательностями и некодирующей ДНК. Практически все человеческие гены имеют интроны, и альтернативный сплайсинг приводит к образованию более чем одного белка в геном. SNP генотипирования коррелирует изменения в геноме с дис- Облегчает или лекарственной чувствительности. Это может привести к персонализированной медицине. Обзор Рисунок 17,15 Pharmacogenomics является анализ генетики применительно к метаболизму наркотиков. Что Новые Дисциплины протеомики и метаболомики Показывают ли? Протеое это общее содержание белка в организме. Есть несколько белков, чем белок-кодирующих генов в геноме. Протеый может быть проанализированы с использованием химических методов, которые отделяют и идентифицируют белки. Они включают в себя двумерный электрофорез и масс-спектрометрии. Смотри рисунок 17,17 Метабол это общее содержание малых молекул, такие как промежуточные продукты в метаболизме, гормоны и вторичные метаболиты. СМОТРИ WEB АКТИВНОСТЬ 17.1 для обзора концепции этой главы. SELF ВИКТОРИНА 385 SELF-ВИКТОРИНА эукариотический белок-кодирующих генов отличаются от их аналогов prokary- отических в том, что эукариотических генов двухцепочечной. присутствуют только в единственном экземпляре. содержат интронов. у промоутеров. транскрибируется в мРНК. Сравнение геномов дрожжей и бактерий показывает, что только дрожжи имеют много генов для энергетического метаболизма. синтез клеточной стенки. внутриклеточный белок таргетинга. ДНК-связывающие белки. РНК-полимераза. Геном дрозофилы и нематод аналогичны дрожжи, за исключением того, что бывшие организмы имеют много генов для межклеточной сигнализации. синтез полисахаридов. регуляции клеточного цикла. внутриклеточный белок таргетинга. заменяемые элементы. Минимальный геном Mycoplasma гениталий имеет 100 генов. было использовано для создания новых видов. имеет РНК-геном. больше, чем геном E.coli. был получен путем транспозонного мутагенеза. Что не относится к метагеномика? Это было сделано с бактериями. Это делается на рРНК. Он показал много новых метаболических возможностей. Она включает в себя извлечение ДНК из окружающей среды. Это может быть сделано на морской воде. Транспозоны всегда используют РНК для репликации. приблизительно 50 пар оснований. состоят из ДНК или РНК. не содержат гены, кодирующие белки. составляют около 40 процентов генома человека. Позвоночные семейства генов имеют в основном неактивные гены. включают глобины. не производится генными дупликациями. увеличить количество уникальных генов в геноме. не транскрибируется. Последовательности ДНК, которые кодируют эукариотической рРНК транскрибируются только на рибосоме. повторяются сотни раз. содержат все гены, кластерные непосредственно рядом друг с другом. находятся только на одной хромосомы человека. идентичны последовательностям, которые кодируют микроРНК. Геном человека содержит очень мало повторяющихся последовательностей. имеет 3,3 млрд пар оснований. секвенировали только иерархической последовательности. имеет гены, равномерно распределены вдоль хромосом. имеет несколько генов с интронов. Какие из перечисленных ниже о последовательности генома верно? В иерархической последовательности, но не высокой пропускной последовательности, ДНК усиливается в векторах БАК. В иерархической последовательности, генетическая карта сделана после того, как ДНК секвенировали. Ружье секвенирование значительно медленнее, чем иерархическое секвенирование. Геном человека впервые был секвенирован с помощью методов, с высоким уровнем пропускной способности. Определение последовательности ДНК методом обрыва цепи является основой только дробовика последовательности. Для обсуждения в крыс, белок-кодирующей ген п.о. 1440 кодирует фермент, состоящий из 192 аминокислот. Обсудите это явное несоответствие. Как долго начальные и конечные транскрипты мРНК быть? Геномы риса, пшеницы, кукурузы и похожи друг на друга и An- к тому, что из Arabidopsis во многих отношениях. Обсудите, как эти растения могли бы все-таки очень разные белки. Почему протеая и Метабол более сложный, чем геном? Доследование Этого 2025. Вы заботитесь о пациенте, который со- рый о наличии ранней стадии рака почки год. Его мать умерла от этой болезни. Предположим, что ОНП, связанные с генами, участвующими в Сектор девелоперских этого типа рака, были идентифицированы. Как бы вы определить, является ли этот человек имеет генетическую predisposi- Тион для развития рака почек? Объясните, как вы могли бы сделать анализ. Как вы могли бы разработать метаболомики профиль для рака почки, а затем использовать его, чтобы определить, имеет ли ваш пациент рак почки? Если у пациента был диагностирован рак с помощью методов и (б), как бы вы использовать фармакогеномику выбрать правильные лекарства для лечения опухоли у данного пациента?